ATP aptamer

Jan 2, 2024 • Zhizhong Lu, Yangyi Ren

Timeline

Description

In 1993, Szostak et al. employed in vitro selection techniques to isolate aptamers with high-affinity binding sites for ATP. Subsequently, they used this motif to design ribozymes displaying polynucleotide kinase activity. In 1996, Dinshaw J. Patel et al. elucidated the structure of the aptamer complexed with AMP using multidimensional nuclear magnetic resonance spectroscopy and molecular dynamics calculations^[1].

SELEX

In vitro selection experiments involve the construction of alarge pool of random polynucleotide sequences,followed byrepeated cycles of enrichment for species with the desired proper-ties and amplification of the enriched pool.We started with apool of RNAs 169 nucleotides long,with a complexity of ~1014 different sequences.RNA molecules able to bind ATP wereselected by affinity chromatography on ATP-agarose columns,with the ATP linked to the agarose at its C8 position.RNA molecules that were retained by the ATP-agarose matrixwere affinity-eluted with ATP.Theeluted RNA was amplified by reverse transcription and polymer-ase chain reaction (PCR).In vitro transcription of the double-stranded DNA templates obtained in this manner yielded anenriched pool of RNAs for a new cycle of selection.After sixrounds of selection and amplification,a population of RNAsthat eluted specifically with ATP.sequenced 39 clones from the eighth cycle RNA popula-tion and found 17 different sequences. The aptamer adopts Capture-SELEX method^[1].
Detailed information are accessible on SELEX page.

Structure

2D representation

Szostak et al. obtained 17 different sequences through SELEX, and designed a 40nt sequence after comparing the information of 17 sequences. The aptamer of the 40nt is a sequence of analytic structures, and the following diagram shows its secondary structure. Here we use ribodraw to complete the figure, through the 3D structure information. Through SELEX, 17 different sequences were obtained, and after comparing 17 sequence information, a 40nt sequence was designed ^[2].

5'GGGUUGGGAAGAAACUGUGGCACUUCGGUGCCAGCAACCC3'

3D visualisation

Roger A.Jones & Dinshaw J. Patel et al. present the solution structure, as determined by multidimensional NMR spectroscopy and molecular dynamics calculations, of both uniformly and specifically C13, N15-labelled 40-mer RNA containing the ATP-binding motif complexed with AMP. The PDB ID of this structure is 1AM0. Then,T Dieckmann & J Feigon et al.present the three-dimensional solution structure of a 36-nucleotide ATP-binding RNA aptamer complexed with AMP, determined from NMR-derived distance and dihedral angle restraints. The PDB ID of this structure is 1RAW. Here only the structural diagram of 1RAW is shown. There is no obvious difference between the structures of 1AM0 and 1RAW^[3]. Additional available structures that have been solved and detailed information are accessible on Structures page.

Binding pocket

Left: Surface representation of the binding pocket of the aptamer generated from PDB ID: 1RAW by NMR. Adenosine monophosphate (AMP)(shown in sticks) is labeled in yellow. Right: The hydrogen bonds of binding sites of the aptamer bound with AMP^[3].

Ligand information

SELEX ligand

Szostak and colleagues utilized several methodologies including isocratic elution from ATP-agarose and equilibrium gel filtration techniques to determine the dissociation constant of the RNA-ATP complex both on the column and in solution. These methods were employed to comprehensively assess the stability and affinity of the RNA-ATP interaction under different experimental conditions, allowing for a robust evaluation of the binding affinity and dynamics between RNA molecules and ATP in varied environments. Adenosine triphosphate (ATP), Deoxyadenosine triphosphate (dATP)^[2].

Structure ligand

Adenosine monophosphate, also known as 5'-adenylic acid and abbreviated AMP, is a nucleotide that is found in RNA. It is an ester of phosphoric acid with the nucleoside adenosine. AMP consists of the phosphate group, the pentose sugar ribose, and the nucleobase adenine. AMP is used as a dietary supplement to boost immune activity, and is also used as a substitute sweetener to aid in the maintenance of a low-calorie diet.-----from drugbank

PubChem CID	Molecular Formula	MW	CAS	Solubility	Drugbank ID
6083	CH14N5O7P	347.22 g/mol	61-19-8	10000mg/L (at 20 °C)	DB00131

Similar compound

We screened the compounds with great similarity to AMP by using the ZINC database and showed some of the compounds' structure diagrams. For some CAS numbers not available,we will supplement them with Pubchem CID.

Zinc_id	Named	CAS	Pubchem CID	Structure
ZINC000002126310	Vidarabine Phosphate	29984-33-6	34768
ZINC000053684016	Alpha-Methylene Adenosine Monophosphate	NA	46936495
ZINC000053684213	6-Chloropurine Riboside, 5'-Monophosphate	NA	70789235
ZINC000004096488	6-Thioinosine-5'-Monophosphate	53-83-8	3034391
ZINC000013543089	6-Methylthiopurine 5'-Monophosphate Ribonucleotide	7021-52-5	3037883
ZINC000003927870	Fludarabine	21679-14-1	657237
ZINC000013543718	Vidarabine Phosphoric Acid	NA	22840996
ZINC000001631259	3'-Adenylic acid	84-21-9	41211

References

[1] An RNA motif that binds ATP.
Sassanfar, M., & Szostak, J. W.
Nature, 364(6437), 550–553 (1993)
[2] In vitro evolution of new ribozymes with polynucleotide kinase activity.
Lorsch, J. R., & Szostak, J. W.
Nature, 371(6492), 31–36 (1994)
[3] Structural basis of RNA folding and recognition in an AMP-RNA aptamer complex.
Jiang, F., Kumar, R. A., Jones, R. A., & Patel, D. J.
Nature, 382(6587), 183–186 (1996)
[4] Solution structure of an ATP-binding RNA aptamer reveals a novel fold.
Dieckmann, T., Suzuki, E., Nakamura, G. K., & Feigon, J.
RNA (New York, N.Y.), 2(7), 628–640. (1996)
[5] Specific labeling approaches to guanine and adenine imino and amino proton assignments in the AMP-RNA aptamer complex.
Jiang, F., Patel, D. J., Zhang, X., Zhao, H., & Jones, R. A
Journal of biomolecular NMR, 9(1), 55–62. (1997)
[6] Structural basis of DNA folding and recognition in an AMP-DNA aptamer complex: distinct architectures but common recognition motifs for DNA and RNA aptamers complexed to AMP.
Lin, C. H., & Patel, D. J.
Chemistry & biology, 4(11), 817–832. (1997)
[7] Examination of the catalytic fitness of the hammerhead ribozyme by in vitro selection.
Tang, J., & Breaker, R. R.
RNA (New York, N.Y.), 3(8), 914–925 (1997)
[8] Imino proton exchange and base-pair kinetics in the AMP-RNA aptamer complex.
Nonin, S., Jiang, F., & Patel, D. J.
Journal of molecular biology, 268(2), 359–374. (1997)
[9] Evolution of aptamers with a new specificity and new secondary structures from an ATP aptamer.
Huang, Z., & Szostak, J. W.
RNA (New York, N.Y.), 9(12), 1456–1463. (2003)
[10] A novel, modification-dependent ATP-binding aptamer selected from an RNA library incorporating a cationic functionality.
Vaish, N. K., Larralde, R., Fraley, A. W., Szostak, J. W., & McLaughlin, L. W.
Biochemistry, 42(29), 8842–8851. (2003)
[11] A small aptamer with strong and specific recognition of the triphosphate of ATP.
Sazani, P. L., Larralde, R., & Szostak, J. W.
Journal of the American Chemical Society, 126(27), 8370–8371. (2004)
[12] Facile conversion of ATP-binding RNA aptamer to quencher-free molecular aptamer beacon.
Park, Y., Nim-Anussornkul, D., Vilaivan, T., Morii, T., & Kim, B. H.
Bioorganic & medicinal chemistry letters, 28(2), 77–80. (2018)